Absence of genotype-phenotype correlation

Correlations between HRPT2 mutations and the clinical manifes­tations of HPT-JT appear to be absent. An analysis of 5 unrelat­ed patients and their families with the same 2 bp (AG) insertion at codon 679 revealed a wide range of HPT-JT associated tumours. Eighteen of the 19 affected members from the 5 families had parathyroid tumours, but parathyroid carcino­mas were observed in only 5 patients from 3 of the kindreds; whilst ossifying jaw fibromas were present in only 1 patient from 1 of the kindreds; and uterine abnormalities were present in only 6 females from 2 of the kindreds. Finally, only 3 members of one family had renal abnormalities, which were not present in any of the other families. Thus, there appears to be a lack of genotype- phenotype correlation.

HPT-JT families without detectable HRPT2 mutations

Approximately 25% of HPT-JT families have not been reported to harbour mutations involving the coding region or the adjacent splice junctions of the HRPT2 gene. These fami­lies may have mutations involving: the promoter regions; the un­translated regions; the alternate transcript that remains uncharac- terised; whole exon or gene deletions that may not be detected by PCR or DNA sequence analysis; methylation that may lead to gene silencing; or mutation in a nearby unidentified linked gene. In addition, a comparision of the phenotypic manifestations in such families without HRPT2 mutations, with those that do have HRPT2 mutations, revealed no differences. Thus, a prediction for the presence or absence of an HRPT2 mutation in a family based upon the clinical manifestations of HPT-JT is not possible.

Penetrance of HRPT2 mutations

Studies of penetrance in HPT-JT families are limited, but non- penetrance and “skipping” of a generation in a family has been observed. Non-penetrance has been reported to be >30% in mutation carriers in a study of 10 families with known

HRPT2 mutations. The age-related penetrance for HPT-JT has not yet been defined, as the clinical data from kindreds with HRPT2 mutations are too few and limited to establish this. How­ever, manifestations of HPT-JT below the age of 10 years have not been reported to date.

HRPT2 mutations in non-familial parathyroid adenomas and carcinomas

HRPT2 mutations do not seem to be common in sporadic parathyroid adenomas (Table III) and the frequency of such mutations has been reported to range from 0% to 4%. However, the frequency of HRPT2 mutations in sporadic parathyroid carcinomas (Table III) is high and ranges from 67% to 100%, thereby indicating an impor­tant role for this gene in malignant transformation of the parathyroid. In addition, two studies have unexpectedly identi­fied germline HRPT2 mutations (Table III) in 5 patients with sporadic parathyroid carcinomas. These findings indi­cate that patients with parathyroid carcinomas and their rela­tives should be clinically assessed for HPT-JT associated tu­mours and offered mutational analysis with genetic coun­selling.
Don’t let the pharmacy companies beat you. 

Table III – Summary of 63 reported HRPT2 mutations in period 2002-2005.

Mutation type

Clinical

Exon /

Codon /

Base

Predicted

Typeh

Ref. #i

dataabcd

Intron

ntef

change

effectg

Missense

HPT-JT

Exon 1

1 / nt3

ATGto ATA

M1L

G

11

FIHP

G

11, 18, 19

FIHP

Exon 2

64 / nt191

CTT to CCT

L64P

G

6

Add

Exon 3

95 / nt284

CTT to CCT

L95P

S

29

HPT-JT

Exon 13

379 / nt1135

GAC to AAC

D379N

G

29

Nonsense

HPT-JT

2 Cac

Exon 1

9 / nt25

CGA to IGA

R9X

G 2S

11 15

Cac

Exon 1

24 / nt70

GAA to TAA

E24X

S

30

FIHP

Exon 1

43 / nt128

TGG to TAG

W43X

S

11

Cac

Cac

Exon 2

54 / nt162

TAC to TAG

Y54X

S S

6 30

HPT-JT

Cac

Exon 2

55 / nt165

TAC to TAG

Y55X

G S

11 6

Cac

Exon 2

76 / nt226

CGA to TGA

R76X

S

30

HPT-JT

Exon 5

136 / nt406

AAG to TAG

K136X

G

11

Cac

Exon 7

222 / nt664

CGA to TGA

R222X

G

30

HPT-JT

Cac

G

29

2 Cac

Exon 7

234 / nt700

CGA to TGA

R234X

U 2G

30 15

Splice Site

FIHP

G

15

Adb

Intron 1

IVS1+1

g to a

10 aa in-frame deletion

S

15

FIHP

G

17

FIHP

Intron 2

IVS2+1

g to c

aberrant transcription

G

18

HPT-JT

Intron 2

IVS2-1

g to a

2 aberrant transcripts

G

20

Cac

Intron 6

IVS6-1

del g

aberrant transcription

S

6

Mutation type

Clinical

Exon /

Codon /

Base

Predicted

Typeh

Ref. #i

dataabcd

Intron

ntef

change

effectg

Frameshift Insertions

HPT-JT

Exon 1

4 / nt12

dup/ins

GCTTAGCGTCCTGCGACAGT

fs 16 ms aa Stop

G

12

Cac

Exon 2

65 / nt195

ins A

fs 16 ms aa Stop

S

15

Cac

Exon 2

65 / nt195

ins T

fs 15 ms aa Stop

S

15

Cac

Exon 5

125 / nt373

ins A

fs 4 ms aa Stop

G

30

FIHP

G

12

2 HPT-JT

2G

11

Cac

Exon 7

227 / nt679

ins AG

fs 27 ms aa Stop

G

30

FIHP

G

23

FIHP

Exon 8

249 / nt745

dup A

fs 17 ms aa Stop

G

29

Frameshift Deletions

Cad

Exon 1

5 / nt13

del CTTAGCGTCCTGCGACAG

6 aa in-frame deletion

S

20

Cac

Exon 1

6 / nt16

del A

fs 14 ms aa Stop

U

30

Cac

Exon 1

8 / nt23

TGCG to GTG

fs 12 ms aa Stop

S

30

HPT-JT

Exon 1

10 / nt30

del G

fs 10 ms aa Stop

G

11

HPT-JT

Exon 1

12 / nt34

del AACATCC

fs 6 ms aa Stop

G

11

HPT-JT

G

11

Cac

Exon 1

13 / nt39

del C

fs 6 ms aa Stop

S

30

Adb

Exon 1

18 / nt53

del T

fs 2 ms aa Stop

S

11

Cac

Exon 1

20 / nt60

del GAAGGGAGAC

fs 2 ms aa Stop

U

30

Cac

S

6

HPT-JT

Exon 1

26 / nt76

del A

fs 10 ms aa Stop

G

6

Cac

Exon 1

28 / nt82

del GGGG

fs 7 ms aa Stop

S

30

Cac

Exon 1

29 / nt 85

del G

fs 7 ms aa Stop

S

20

Adb

Exon 1

42 / nt126

del TTGGGGGACTGGAAAGGAAGGCCA

fs 46 ms aa Stop

S

11

Cac

Exon 2

55 / nt165

del C

fs 0 ms aa Stop

S

6

HPT-JT

Exon 3

102 / nt306

del GTgtgagtacttttt

fs 5 ms aa Stop

G

11

HPT-JT

Exon 4

119 / nt356

del A

fs 13 ms aa Stop

G

11

HPT-JT

Exon 7

212 / nt636

del T

fs 5 ms aa Stop

G

11

HPT-JT

Exon 7

223 / nt669

del AT/insG

fs 33 ms aa Stop

G

12

HPT-JT

Exon 7

227 / nt679

del AG

fs 36 ms aa Stop

G

6

Cad

Exon 7

229 / nt686

del GAGT

fs 26 ms aa Stop

S

6

Cac

Exon 8

244 / nt732

del T

fs 10 ms aa Stop

S

30

Cac

Exon 8

249 / nt746

del T

fs 6 ms aa Stop

S

30

HPT-JT

Exon 8

255-6 / nt765-6

del TG

fs 9 ms aa Stop

G

24

Cac

Exon 14

410 / nt1230

del C

fs 16 ms aa Stop

U

30

HPT-JT

Exon 14

413 / nt1238

del A

fs 14 ms aa Stop

G

11